Why is it that a science question is merely answered on here?

Because a real science question is not asking for an opinion. There are not viewpoints; there are theories based on whatever hard evidence is known.

And when there are competing theories to explain a phenomenon, people on Fluther can be quite vocal. But that is a matter of what evidence one has and ho two weigh one set of facts against another.

Are you asking this based on the one science question you asked an hour ago? Give it some time. A larger percentage of us are qualified to discuss food or books or whatever than astrophysics, so those questions might not get answered by as many people but they’ll get answered.

Answering a science question is just different, you can’t just spout out your opinion, you have to have some background or do research.

Science isn’t really the forum for high imagination, improv and opinion, which are the things that make up a discussion (IE: what everyone else said.)

Well, what are the sequence of nucleic acids in a strand of DNA that make for a true redhead?
Or does he respect me in the morning after we have sex? Which can you relate to.
Bonus question, How do I know she got her rocks off?

ACTACTACTACTACTACTACTACTACTACTACTACTACTACTACTACTACTACTACTACTACT @Adirondackwannabe. Pretty sure, anyway. And that should answer all three questions.

I know there are a few experts in certain scientific fields on this site, but I think the reason for this is mainly because most jellies probably don’t have any professional background or expertise in science.

A lot of us have an interest though, and we’ll follow conversations without adding anything. Usually.

Yes. I have a crapload of interests; Viking history, butterflies, philosophy, but I’m nowhere near an expert in any of these things. The closest I come to would be horror movies, and even then.
Mind you I’m not limiting the experiences of other jellies to my own limits, nor did I answer this to be mean or smart assy. But it is my observation.

@Dutchess_III That’s only three. There’s four. That did answer the other two.

GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG to the last one @Adirondackwannabe. That’s how you know.

Let’s talk about Viking butterflies, @Symbeline!

I don’t get it. What?

Don’t get what @syz?

You asked the question in the General Section of Fluther, @Khajuria9

How is it possible for a gravitational force to warp space-time around itself?

“General Question”

You should read the guidelines

Responses must:

Focus on answering the question
Relate to the discussion and be on-topic
Be respectful; you can disagree without being disagreeable
Adhere to the writing standards

Responses must not:

Be one-liners, jokes, or chit-chat (please be helpful)
Disrupt the discussion
Dismiss the asker (“just Google it”)

I think @Dan_Lyons nailed it. People just try to give you facts, not opinions.

You should flag that question and ask for it to be moved to Social. That way you will get more opinions.

I don’t know @Mimishu1995. You can’t really get an “opinion” on the question How is it possible for a gravitational force to warp space-time around itself? I mean, “Cuz the gravity is REALLY STRONG and it’s so strong it warps light, which is moving at 186,000 miles per second. That’s my opinion.” Pretty lame, if you ask me.

We all have our areas of expertise. I know a lot about baking bread and language disorders but physics? Not so much. Fluther is a small community so you are less likely to find experts in a specific field.